Biomedical Research

All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.
Biomedical Research 44 7897 074717

Short Communication - Biomedical Research (2016) Volume 0, Issue 0

Preliminary report on the incidence of pathogenic Entamoeba histolytica in patients attending out-patient clinic of university of Nigeria teaching hospital, Ituku Ozalla, Enugu-Nigeria

Entamoeba comprises six species that inhabit human intestinal lumen, of which only Entamoeba histolytica (E. histolytica) is positively shown to be pathogenic. It is the causative agent of human intestinal and extra intestinal ameobiasis and responsible for significant morbidity and mortality in many developing countries as well as several communities in developed countries. Entamoeba histolytica is in the WHO list of neglected tropical diseases that requires funding for drug discovery, epidemiology, surveillance and vector control. Indeed, WHO recommends treatment of pathogenic Entamoeba histolytica infection while treatment of non-pathogenic species is unnecessary; hence, the need to use technique that positively identifies the pathogenic specie. Stool samples from patients attending University of Nigeria Teaching Hospital Ituku-Ozalla, for gastrointestinal complaints or diarrhoea were analysed by combined use of polymerase chain reaction and restriction endonuclease digest to positively show the presence of pathogenic Entamoeba histolytica in stool. Thirty samples extracted with commercial genomic DNA extraction kit (DNA extraction buffer, Life River, UK) according to manufacturer’s protocol were subjected to amplification by polymerase chain reaction using primers (Forward: 5′TAAAGCACCAGCATATTGTC3′ and Reverse: 5′GATGACATATCCTCTTCTTG3′). Two of the genomic DNAs were amplified but only one of them contained EcoR1 digestion site suggesting that it is pathogenic Entamoeba histolytica. This represents approximately 3.3% of the total samples studied and is considered significant considering the population at risk. Furthermore the study represents improvement in diagnosis of Entamoeba histolytica using molecular based technique in a local laboratory.

Author(s): Ameh LO, Ikekpeazu JE, Eze AA, Udeogaranya PO, Okoli UA, Ogbunude POJ

Abstract Full Text PDF