Journal of Fisheries Research

All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.
Reach Us +44-7360-538437

Short Communication - Journal of Fisheries Research (2021) Volume 5, Issue 4

Overview of benthos

S Syed Raffic Aliab*, K Ambasankara, P Ezhil Praveenaa

Department of Zoology, ICAR-Central Institute of Brackish Water Aquaculture, Tamil Nadu, India

Corresponding Author:
S Syed Raffic Aliab
Department of Zoology
ICAR-Central Institute of Brackish water Aquaculture
Tamil Nadu
India
E-mail:
[email protected]

Accepted date: 03rd September, 2021

Citation: Aliab SSR, Ambasankar K, Praveena PE, et al. Effect of dietary mannanoligosaccharide on intestinal microbiota and immune parameters of Asian seabass (Lates calcarifer) juveniles. J Fish Res 2021; 5(5):16-21.

Visit for more related articles at Journal of Fisheries Research

Abstract

The benthos is comprised of all the organisms that live at the bottom of a body of standing or running water. The layer that the benthos possess is known as the benthic zone, which is the most lowest layer of a lake, ocean, stream, or waterway. This zone, obviously, goes from the shallow deapths where water meets land, to outrageous profundities that people have not yet had the option to investigate. Benthos, thusly, fluctuate incredibly, and can either be noticed creeping, tunneling, swimming close to the base, or staying attached to the substrate. Many tend to rely on food sources that sink down to the base, like inorganic matter and dead creatures, yet the benthos likewise feed on each other. The zone over the benthic zone where life forms that swim or float the pelagos are found is known as the pelagic zone.

Keywords

Asian sea bass, Immune parameters, Mannanoligosaccharide, Micro biota.

Introduction

Asian seabass Lates calcarifer (Bloch) popularly called as barramundi is a carnivorous, euryhaline, commercially valuable food fish widely cultured in tropical and subtropical regions of Asia and Pacific countries in marine, brackish and fresh water resources [1]. Because of its high market value and excellent growth potential sea bass is considered as an alternate candidate species in brackish water aquaculture in India [2]. Bacterial and viral diseases are the major outbreaks in aquatic organisms causing considerable economic losses in aquaculture industry [3]. Antibiotics and chemo-therapeutics are the most commonly used therapeutic agents to prevent/control these aquatic diseases, such as suppression of aquatic animal’s immune system, drug resistant, food safety problems etc [4]. As an alternatives for the antibiotics, use of prebiotics such as Arabinoxylooligosaccharides (AXOS), Fructooligosaccharides (FOS), Galactooligosaccharides (GOS), Isomaltooligosaccharides (IMO), inulin and Mannanoligosaccharides (MOS), and Xylooligo-saccharides (XOS), has been effective to disease control, immune system activation, and promoting the growth and health of aquatic organisms [5].

Mannanoligosaccharides is one of the prebiotics widely used in various fish species to modulate growth performance, survival and immune-related parameters [6-8]. MOS is composed of complex carbohydrate molecules, derived from the outer cell wall of the yeast Saccharomyces cerevisiae, whose main components are β-glucans (mannoproteins) are known as elements capable of activating the immune systems of animals [9]. The mode of action of MOS is based in two main functions blocking pathogen colonization and modulating immune system [10]. Several studies have showed the benefits of prebiotics on the growth performance, survival, physiological status, digestive enzyme activities, and immune response etc. [1,11,12]. Therefore the current study was investigated to evaluate the effect of MOS on intestinal micro biota and immune parameters in the diet of Asian sea bass juveniles.

Materials and Methods

Preparation of experimental diets

The experimental diets used in the present study were formulated to contain approximately 40% protein and 8% lipid, which is sufficient for the optimal growth of Asian sea bass juveniles. Diets were prepared by supplementing MOS in the standard sea bass diet at four different concentrations at 0%, 0.5%, 1%, 1.5% and 2% levels following the methods of MOS (mannanoligosaccharide) study. The proximate composition of the ingredients and experimental diets (Tables 1 and 2) were analyzed by following standard procedures of MOS [13].

Diets/
Ingredients (%)
MOS 0% MOS 0.5% MOS 1% MOS 1.5% MOS 2%
Fish meal1 40 40 40 40 40
Soybean meal 25 25 25 25 25
Wheat 14 14 14 14 14
Rice 5 5 5 5 5
Maize 5 5 5 5 5
Fish oil1 4 4 4 4 4
Lecithin 1 1 1 1 1
Vitamin and Minerals2 3 3 3 3 3
Binder3 1 1 1 1 1
Cellulose 2 1.5 1 0.5 0
MOS4 0 0.5 1 1.5 2

Table 1: Ingredient composition (%) of experimental diets containing varying levels of MOS.

Diets MOS 0% MOS 0.5% MOS 1% MOS 1.5% MOS 2%
Moisture 8.75 8.26 8.44 8.20 8.24
Crude protein 40.32 40.37 40.36 40.32 40.46
Crude lipid 8.83 8.82 8.85 8.81 8.84
Crude fiber 2.16 2.12 2.27 2.12 2.15
Total ash 14.08 14.01 14.47 14.12 13.10
NFE 25.86 26.42 25.61 26.43 27.21

Table 2: Proximate composition (%) of experimental diets containing varying levels of MOS.

Feeding trial

Asian sea bass juveniles (average body weight of 8.0 g) were obtained from the Kuluthumedu village from the (Women self-help groups Ponneri, Chennai) were randomly allocated into 15 tanks (1000 L) at a density of 15 fish per tank (3 tanks per treatment). The tanks were supplied with sand-filtered seawater with continuous aeration through air diffuser stones. During the experimental trial, which lasted for 60 days the fishes were hand fed twice a day (morning 9.00 and evening 15.00 hrs). The fecal matter was removed daily before feeding. In Table 3 water quality parameters pH, temperature, salinity, dissolved oxygen and total ammonia nitrogen was analyzed as per the standard procedures of American Public Health Association, 1998. [14].

S.No Water parameters Values
1 pH 7.2-8.1
2 Temperature 26ºC -28ºC
3 Salinity 28-35 g L-1
4. Dissolved oxygen 6.0-7.3 mg L-1
5. Total ammonia nitrogen 0.08-0.11 mg L-1

Table 3: Water quality parameters.

Blood sampling

At the end of the feeding experiment, fishes were starved for 24 h before sampling. Three fish from each replicate were randomly collected and anaesthetized (2-phenoxyethanol at 0.5 ml/L) for blood sample collection [1].

Serum immune parameters

The serum immune parameters lysozyme activity, Alternative complement pathway activity, superoxide dismutase assay and nitroblue tetrazolium assay was carried out following the protocols of Ali SR, et al. research work [1].

PCR-DGGE analysis and sequencing

DNA extraction, Polymerase Chain Reaction-Denaturing Gradient Gel Electrophoresis (PCR-DGGE) and sequencing analysis was performed as described in Table 4 [15-17].

Primer Sequence (5' to 3') Reference
357f CCTACGGGAGGCAGCAG Muyzer,
et al.
357f-GC GCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGG
GGGGCCTACGGGAGGCAGCAG
907rM CGTCAATTCMTTTGAGTTT

Table 4: 16S rRNA primers used in this study.

Statistical analysis

Data were subjected for statistical analysis using one-way ANOVA and the means were compared using Duncan’s multiple range test. Mean values were considered significantly different at p<0.05. Statistical analysis was performed with SPSS statistical package ver.17.0 (SPSS, Chicago, USA).

Results

The serum immune parameters lysozyme, ACP, SOD and NBT assay of Asian sea bass fed diets supplemented with FOS showed significant (p<0.05) differences between control and treatment groups. Highest lysozyme, ACP, SOD and NBT activity was observed in fish fed with 1.5% and 2% MOS supplemented diet compared various treatments (Figures 1-6).

Figure 1: Fish rearing and experimental design.

Figure 2: Lysozyme activity of seabass fed experimental diets supplemented with varying levels of MOS for 60 days (Mean ± SD) (n=3). Bars assigned with different superscripts are significantly different (p<0.05).

Figure 3: ACP activity of seabass fed experimental diets supplemented with varying levels of MOS for 60 days (Mean ± SD) (n=3). Bars assigned with different superscripts are significantly different (p<0.05).

Figure 4: SOD activity of seabass fed experimental diets supplemented with varying levels of MOS for 60 days (Mean ± SD) (n=3). Bars assigned with different superscripts are significantly different (p<0.05).

Figure 5: NBT assay of seabass fed experimental diets supplemented with varying levels of MOS for 60 days (Mean ± SE) (n=3). Bars assigned with different superscripts are significantly different (p<0.05).

Figure 6: Effect of MOS on the gut microbial community in the intestinal contents of seabass as evaluated by denaturing gradient gel electrophoresis of bacterial 16S r DNA amplicons. C and M1=control diet (0%) MOS, M 2 and M3=(0.5%) MOS, M4 and M5=(1%) MOS, M6 and M7=1.5%) MOS, M8 and M9=(2%) MOS.

Denaturing Gradient Gel Electrophoresis (DGGE) of bacterial 16S rDNA amplicons from Asian sea bass intestinal contents obtained in trial is shown in Figure 6. The Polymerase chain reaction PCR and DGGE analysis of gut samples of sea bass fed with different levels of MOS supplemented diets was found to fail to increase the bacterial diversity.

Discussion

This is the first study to report the efficacy of MOS on gut microbiota and immunological parameters in Asian sea bass juveniles. The lysozyme activity of sea bass fed diets supplemented with MOS showed significant difference between control and treatment groups. The highest lysozyme activity was observed in fish fed with 2% MOS supplemented diet compared to various treatments. Similar to our results reported that Cyprinus carpio fed with 4.5 g kg-1 MOS supplemented diet had significantly higher serum lysozyme activity compared to the rest of the diets [6]. Dietary supplementation of prebiotics MOS in fish diets elevates the antibacterial activities, gut mucus and lysozyme and [18]. Lysozyme activity is an important index of innate immunity of fish and is ubiquitous in its distribution among living organisms, and it is an important enzyme in blood that actively lyses bacteria an increased levels has been considered to be a natural protective mechanism in fish [19]. ACP and SOD activity of sea bass fed with MOS supplemented diets showed significant differences between control and treatment groups. Higher ACP and SOD activity was recorded in fish fed with 2% MOS supplemented diet. Similarly reported that serum ACP was significantly higher in fish fed with 4.5 g kg-1 MOS compared to fish fed with control diet. Similarly reported that 0.1% and 0.2% MOS supplementation could significantly increase SOD activity in sea cucumber [20]. The complement system is essential for the innate immune system of the fish and is most well-known for its capacity to kill pathogens by creating pores in their surface membranes or by opsonizing pathogens by stimulating phagocytosis. The ACP activity is very active in fish serum when compared to mammals, this pathway is very important in the defence mechanism of fish [21]. Superoxide dismutase constitutes a very important antioxidant defense against oxidative stress in the body of fish [22]. This enzyme acts as a good therapeutic agent against reactive oxygen species-mediated disease [23]. The NBT assay sea bass fed with MOS supplemented diets showed significant difference between control and treatment groups. The fish fed with 1.5% MOS supplemented diet showed highest NBT compared to rest of the treatments. Similarly it was reported that in African catfish, fed with MOS supplemented diets showed increased NBT activity during the first two weeks and then decreased back to the control level after 45 days [24].

The effect of MOS supplementation on the intestinal microbial community of sea bass was analyzed using PCR-DGGE. MOS was found to fail to increase the bacterial diversity in sea bream reported that MOS can influence the intestinal microbiota in terms of microbial abundance and species richness and this positive effect in microbial diversity [25]. Previous studies have reported that the effect of dietary MOS on fish intestinal microbiota in rainbow trout juveniles fed with 0.2% MOS supplemented diets for 111 days showed decreased viable Aeromonas/vibrio sp, Micrococcus sp. and gram positive rod bacterial populations and increased Enterococcus sp. and Enterobacteriaceaelevels. The same fish species fed with MOS supplemented diets for fifty eight days showed increase in Pseudomonas sp. levels and reduction in Micrococcus sp. [26].

Conclusion

The current study effect of dietary mannanoligosaccharide on intestinal micro biota and immune parameters of Asian seabass (Lates calcarifer) juveniles showed that MOS is a beneficial prebiotic supplement for improving the immunological parameters of Asian sea bass. However, further research is required to conclusively ascertain the prebiotic effect of MOS supplementation for enhancing the gut microbiota and disease resistance.

Acknowledgements

The Authors express sincere and profound sense of gratitude to Dr.K.K.Vijayan, Director, Central Institute of Brackishwater Aquaculture for providing necessary facilities for carrying out this work.

References

Get the App