International Journal of Pure and Applied Zoology

All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.
Reach Us +44-7360-538437

Research Article - International Journal of Pure and Applied Zoology (2022) Volume 10, Issue 9

A comparison of rare alleles of ABO blood group system in three Asian populations

Ghani Ur Rehman1*, Hong Shi1, Muhammad Ali2, Muhammad Rahman Ali Shah3, Muhammad Awais4

1Yunnan Key Laboratory of Primate Biomedical Research, Institute of Primate Translational Medicine, Kunming University of Science and Technology, Kunming, Yunnan, China
2Department of Biotechnology, Bacha Khan University Charsadda, Khyber Pakhtunkhwa, Pakistan
3Department of Genetics, College of Life Sciences and Technology, Harbin Normal University, Heilongjiang, China
4 Department of Life Sciences, Kunming University of Sciences and Technology, Kunming, China

*Corresponding Author:
Ghani Ur Rehman
Yunnan Key Laboratory of Primate Biomedical Research
Institute of Primate Translational Medicine
Kunming University of Science and Technology
Kunming, Yunnan, China
E-mail: [email protected]

Received: 25-Aug-2022, Manuscript No. IJPAZ-22-72900;Editor assigned: 29-Aug-2022, PreQC No. IJPAZ-22-72900(PQ);Reviewed: 12-Sep-2022, QC No. IJPAZ-22-72900;Revised: 15-Sep-2022, Manuscript No. IJPAZ-22-72900(R);Published: 22-Sep-2022, DOI: 10.35841/2320-9585-10.9.141

Visit for more related articles at International Journal of Pure and Applied Zoology

Abstract

Genotyping of the ABO blood group system has been carried out on the Chinese population and compared with the other two Asian populations the Japanese and Korean populations. We performed the PCR-RFLP, PCR-SSP, and PCR direct sequencing approach for the analysis of the nucleotide at 11 positions, nts 261, 297, 467, 526, 646, 681, 703, 796, 802, 803, and 1060. Apart from the common alleles, we detected three rare alleles in our study: A1(Pro) (=A101), A2(Leu) (=A201), B (=B101), O(T) (=O01), O(A) (=O02), and O2 (=O03), A1(Leu) (=A102). Names for the rare alleles of the ABO gene were used according to the dbRBC; Ov1, Bv2, Bv in the Chinese population. The comparison of these rare alleles with the other two Asian populations showed that based on these rare alleles the frequency is similar in the Chinese and Japanese populations but this frequency in Korean population is different from the Chinese population. According to our results, the Chinese population is similar to the Japanese as compare to the Korean population.

Keywords

Blood Group Genotyping, Rare Alleles, ABO Gene.

Introduction

Clinical and transfusion medicine, forensics research, as well as transfusion medicine rely on the ABO as the most comprehensive and clinically essential blood group system. In fact, over 300 different ABO alleles have already been found, according to the International Society of Blood Transfusion (ISBT). In the population throughout the world, ABO weak phenotypes can be determined by the pattern of A or B antigens appearing on the membrane surface of red blood cells in a multitude of populations However, the ABO weak phenotypes are infrequent in the Chinese population, with a prevalence rate of roughly 0.015 % [1-4]. The ABO cDNA cloning molecular genetics basis dates back to 1990, it was the first instance when Yamamoto performed it [5]. Although numerous ABO polymorphisms produced by variations in the gene's coding domain have been found, however, the molecular mechanisms behind some of these variants are still unknown, necessitating more research. This article presents the alleles of Chinese populations and compare them to the Japanese and Korean populations.

Materials and Methods

According to the present study, we investigated 200 samples of the Chinese population from Yunnan province of China. The most common methods widely used for ABO blood group genotyping in forensic case work, PCR-RFLP and PCR-SSP analysis were used to examine nucleotide at 11 positions i.e., nt 261, 297, 467, 526, 646, 681, 703, 796, 802, 803 and 1060 [6-8]. We compare our findings in this study with Japanese and Korean populations [9-11]. The ABO alleles distribution data for Japanese and Korean populations were taken from the available literature. Google Scholar, PubMed, Scihub were searched for the retrieval of literature. A direct PCR sequencing approach was used for the confirmation of the rare ABO alleles sequence. Primers of different lengths previously used; GA19, GA20, and GA22 were applied the sequence analysis stretched between nt804 and nt1106. The detail of primers is given in (Table 1).

Name Sequence (5´-3´) Direction/Specificity Location Ref.
GA19 GATTTCTACTACCTGGGGAG (Sense primer) A-and-O-allele specific nt784–803 [12]
GA20 GATTTCTACTACCTGGGGGG (Sense primer) B-allele Specific nt784–803 [12]
GA22 CTAAAACCAAGGGCGGGAGG (Anti sense primer) nt1126-nt1107 [13]

Table 1. Primers used for sequence analysis from nt804 to nt1106.

Results and Discussion

In addition to the commonly available allele in the Asian population i.e *A1(Pro) (=*A101), *A2(Leu) (=*A201), B (=*B101), *O(T) (=*O01), *O(A) (=*O02), and *O2 (=*O03), *A1(Leu) (=*A102) (Table 2), we detected three rare alleles in our study: Names for the rare alleles of the ABO gene were used according to the dbRBC; *Ov1, *Bv2, *Bv. *Ov1 showed a single nucleotide deletion at position nt261, while the nucleotides at the remaining 10 sites were similar observed in *A1 (Lue). *Bv2 samples were identified as belonging to the B blood group in the serological methods however, the nucleotide sequence of the blood group at 10 position were identical with the exception of nt297A>G, to (A1Pro). Likewise in the case of the Bv, the nucleotide was Adenine at nt297 but the rest of the sequence was same as the B allele. The distribution of the genotype’s frequency of the ABO blood groups are given in (Table 3).

Allele nt 261 297 467 526 646 681 703 796 802 803 1060
1(Pro)   G A C C T G G C G G C
*A1(Leu)   - - T - - - - - - - -
A2(Leu)   - - T - - - - - - - d
O(T)   d - - - - - - - - - -
'O(A)   d G - - A A - - - - -
O2   - - - G - - - - A - -
Ovl   d - T - - - - - - - -
*B   - G - G - - A A - C -
Bv2   -   - - - - - - - - -
Bv   - - - G - - A A - C -

Table 2. Nucleotide at 11 positions in ABO gene.

Genotype Population
  Chinese. No. (%) Japanese. No. (%) Korean. No. (%)
*A1(Pro)/ *A1(Pro) 03 01.50 06 02.37 09 02.35
*A1(Pro)/ *A2(Leu) 24 12.00 26 10.40 31 08.12
*A2(Leu)/ *A2(Leu) 08 04.00 04 01.58 14 03.66
*A1(Pro)/ *O(T) 02 01.00 28 11.06 27 07.06
*A1(Pro)/*O(A) 16 08.00 03 01.18 26 06.80
*A2(Leu)/*O(T) 20 10.00 18 07.11 32 08.37
*A2(Leu)/*O(A) 01 00.50 02 00.79 07 01.83
*A1(Pro)/*O2 13 06.50 1901 07.50 27 07.06
*A1(Pro)/*Ov1 01 00.50 02 00.79 02 00.52
*A1(Pro)/*B 07 03.50 14 05.53 08 02.09
*A2(Pro)/ *B 03 01.50 03 01.18 10 02.62
*B/*B 18 09.00 21 08.30 26 06.80
*B/*Bv 01 00.50 01 00.39 06 01.57
*B/*O(T) 25 12.50 28 11.06 26 06.80
*B/*O(A) 04 02.00 08 03.16 10 02.62
*B/*O2 04 02.00 07 02.76 28 07.32
*B/Bv2 01 00.50 01 00.39 01 00.26
*O(T)/Ov1 01 00.50 01 00.39 02 00.52
*O(T)/ *O(T) 26 13.00 21 08.30 30 07.85
*O(A)/ *O(A) 06 03.00 06 02.37 20 05.23
*O(T)/*O(A) 16 08.00 13 05.13 40 10.47

Table 3. Genotype occurrence in three Asian populations.

In comparison to the Japanese and Korean populations the common genotypes of the ABO gene were found in all the three Asian population which have nearly the same genotypic frequencies as can be seen in table 3 however, the rare alleles showed some differences in these three populations. The most prevalent rare allele Bv showed increased frequency of 1.57% in Korean population, while this frequency was 0.50% and 0.39% in Chinese and Japanese populations respectively. Bv2 were similar in Chinese and Japanese population however, in Korean population the frequency for this rare blood type allele has very low with 0.26%. Ov1 type showed increased frequency compared to the Chinese 0.50% and Korean 0.39% table no.3. Our results showed that the frequency of the rare allele was similar in Chinese and Japanese population however, it is different Korean population. In our study, the finding is consistent with studies conducted in Asian populations [12-16].

Conclusion

In our study, we found that *A1(Pro) (=*A101), *A2(Leu) (=*A201), *B (=*B101), *O(T) (=*O01), *O(A) (=*O02), and *O2 (=*O03), *A1(Leu) (=*A102) alleles are commonly available in Asian population. We also find three rare alleles, which we compared in these populations which showed varied frequencies. On the basis of these ABO rare alleles, we concluded that the Chinese and Japanese population are similarities in their genetic makeup of the ABO gene as compare to the Korean population which showed slightly different allele frequency.

References

  1. Hult, A.K., Yazer, M.H., Jorgensen, R., Hellberg, A., Hustinx, H., Peyrard, T., and Olsson, M.L., 2010. Weak A phenotypes associated with novel ABO alleles carrying the A2-related 1061C deletion and various missense substitutions. Transfusion., 50: 1471-1486.
  2. Indexed at, Google Scholar, Cross Ref

  3. Moller, M., Joud, M., Storry, J.R., and Olsson, M.L., 2016. Erythrogene: a database for in-depth analysis of the extensive variation in 36 blood group systems in the 1000 Genomes Project. Blood Adv., 1: 240-249.
  4. Indexed at, Google Scholar, Cross Ref

  5. Patnaik, S.K., Helmberg, W., and Blumenfeld, O.O., 2012. BGMUT: NCBI dbRBC database of allelic variations of genes encoding antigens of blood group systems. Nucleic. Acids. Res., 40: D1023-D1029.
  6. Indexed at, Google Scholar, Cross Ref

  7. Ying, Y.L., Hong, X.Z., Xu, X.G., Chen, S., He, J., Zhu, F.M., and Xie, X.Y., 2020. Molecular basis of ABO variants including identification of 16 novel ABO subgroup alleles in Chinese Han population. Transfus. Med. Hemother., 47: 160-166.
  8. Indexed at, Google Scholar, Cross Ref

  9. Yamamoto, F.I., Clausen, H., White, T., Marken, J., and Hakomori, S.I., 1990. Molecular genetic basis of the histo-blood group ABO system. Nature., 345: 229-233.
  10. Indexed at, Google Scholar, Cross Ref

  11. Fukumori, Y., Ohnoki, S., Shibata, H., and Nishimukai, H., 1996. Suballeles of the ABO blood group system in a Japanese population. Hum. Hered., 46: 85-91.
  12. Indexed at, Google Scholar, Cross Ref

  13. Fukumori, Y., Ohnoki, S., Shibata, H., Yamaguchi, H., and Nishimukai, H., 1995. Genotyping of ABO blood groups by PCR and RFLP analysis of 5 nucleotide positions. Int. J. Legal Med., 107: 179-182.
  14. Indexed at, Google Scholar, Cross Ref

  15. Nishimukai, H., Okiura, T., Shinomiya, T., Fukumori, Y., Ohnoki, S., Shibata, H., and Vogt, U., 1996. Genotyping of the ABO blood group system: analysis of nucleotide position 802 by PCR-RFLP and the distribution of ABO genotypes in a German population. Int. J. Legal Med., 109: 90-93.
  16. Indexed at, Google Scholar, Cross Ref

  17. Kang, S.H., Fukumori, Y., Ohnoki, S., Shibata, H., Han, K.S., Nishimukai, H., and Okubo, Y., 1997. Distribution of ABO genotypes and allele frequencies in a Korean population. Jpn. J. Hum. Genet., 42: 331-335.
  18. Indexed at, Google Scholar, Cross Ref

  19. Kim, T.Y., Yu, H., Seo, J.Y., and Cho, D., 2022. Molecular basis of weak A subgroups in the Korean population: Identification of three novel subgroup-causing variants in the ABO regulatory regions. Transfusion., 62: 286-291.
  20. Indexed at, Google Scholar, Cross Ref

  21. Okiura, T., Fukumori, Y., Nishimura, K., Orimoto, C., Fujii, K., and Nishimukai, H., 2003. A-elute alleles of the ABO blood group system in Japanese. Leg. Med., 5: S207-S209.
  22. Indexed at, Google Scholar, Cross Ref

  23. Danzer, M., Polin, H., Stabentheiner, S., Hartmann, C.C., Lennartz, K., and Gabriel, C., 2010. Comprehensive polymorphism analysis of ABO using allele-specific separation by bead technology and subsequent sequencing. Vox. Sang., 98: 451-454.
  24. Indexed at, Google Scholar, Cross Ref

  25. Nishimukai, H., Fukumori, Y., Tsujimura, R., Okiura, T., Tanabe, R., Orimoto, C., and Ueda, N., 2009. Rare alleles of the ABO blood group system in two European populations. Leg. Med., 11: S479-S481.
  26. Indexed at, Google Scholar, Cross Ref

  27. Chun, S., Choi, S., Yu, H., and Cho, D., 2019. Cis-ab, the blood group of many faces, is a conundrum to the novice eye. Ann. Lab. Med., 39: 115-120.
  28. Indexed at, Google Scholar, Cross Ref

  29. Maeda, K., Nakamura, S., Murakami, C., Irie, W., Watanabe, T., Sasaki, C., and Kurihara, K., 2013. ABO genotyping by TaqMan assay and allele frequencies in a Japanese population. Leg. Med., 15: 57-60.
  30. Indexed at, Google Scholar, Cross Ref

  31. Zhu, F., Tao, S., Xu, X., Ying, Y., Hong, X., Zhu, H., and Yan, L., 2010. Distribution of ABO blood group allele and identification of three novel alleles in the Chinese Han population. Vox Sang., 98: 554-559.
  32. Indexed at, Google Scholar, Cross Ref

Get the App