Research Article - Asian Journal of Biomedical and Pharmaceutical Sciences (2017) Volume 7, Issue 61
A Water Extract of Benefiting-Bone Capsule Improves Osteoporosis via Transcriptional and Translational Regulation of Key Factors in Notch and Wnt/Îò-catenin Signaling Pathways in Ovariectomized Rats
Yingquan Xiong1#, Hengrui Liu1#, Jiefang Wang1, Lu Xiang1, Zhidi Wu2, Haixia Wang2, Ling Ou2,Xiaoyun Li2, Xiaoguang Liu2, Haibin He2, Bojia Peng2, Shu Mo2, Xunqian Peng2, Ya Tian2, Panpan Wang2, Ji Fang3, Li Yang1#*, Xiaofeng Zhu1#*, Ronghua Zhang1*
1Jinan University College of Pharmacy, Guangzhou, P. R. China
2First Affiliated Hospital of Jinan University, Jinan University, Guangzhou, P. R. China
3Jinan University College of Medicine, Guangzhou, P. R. China
#Contributed equally to this work.
- *Corresponding Authors:
- Ronghua Zhang
Jinan University College of Pharmacy
Guangzhou, P. R. China.
Tel: 86 20 8522 8578
Fax: +86 20 8522 0007
E-mail: tzrh@jnu.edu.cn
- Xiaofeng Zhu
Jinan University College of Pharmacy
Guangzhou, P. R. China.
Tel: 86 02038688635
Fax: +86 02038688635
E-mail: zxiaof@jnu.edu.cn
- Li Yang
Jinan University College of Pharmacy
Guangzhou, P. R. China.
Tel: 86 20 3837 5176
Fax+8620 3837 5176
E-maildoctormonkey@126.com
Accepted on May 09, 2017
Abstract
Benefiting-Bone Capsule (BBC) is a Chinese herbals formula that shows promise in the treatment and prevention of osteoporosis (OP), but the mechanisms underlying its anti-osteoporotic effects are yet to be established. Here we detect the influence of the extract on several targets of the Notch and Wnt/β- catenin signaling pathways in bone tissue of ovariectomized rats as a model of OP with the aid of realtime PCR, western blot, and immunohistochemical staining. The water extract of BBC exerted a pronounced beneficial effect on OP rats and activated the Wnt/β-catenin pathway through regulating Wnt3a, Wnt10b protein, and glycogen synthesis kinase 3β (GSK-3β) mRNA. Furthermore, the BBC extract inhibited Jagged1, 2 protein and Notch 1,2 mRNA of the Notch signaling pathway. We detected simultaneous changes in the levels of a number of downstream transcripts, including increased runtrelated transcription factor 2 (Runx 2) and decreased peroxisome proliferator-activated receptor γ (PPARγ), which were closely correlated with the treatment effect. Based on the collective findings, we propose that the water extract of BBC regulates OP-associated factors through modulation of key transcripts and proteins in the Notch and Wnt/β-catenin pathways. Our results provide further mechanistic evidence supporting the clinical efficacy of BBC in the treatment of OP.
Keywords
Water extract of benefiting-bone capsule; Osteoporosis; Notch; Wnt/β-catenin
Introduction
Osteoporosis (OP) is a metabolic bone disease, characterized by low bone mass and microarchitectural deterioration, resulting in increased bone fragility and susceptibility to fracture [1]. Typically, OP patients have a high rate of bone remodeling with an imbalance leading to bone resorption in excess of bone formation. Globally, osteoporosis affects approximately one-tenth of women by 60 years of age and twofifths of women by 80 years of age [2]. In view of the increasingly aging population, osteoporosis is becoming a global health problem and its incidence and consequent economic and social costs are expected to rise in the future [3].
Various drugs have been developed to reduce osteoporosis and risk of associated fractures, such as calcium, vitamin D, and bone resorption inhibitors (estrogen, selective estrogen receptor modulators, bisphosphonates). However, these drugs also induce several side effects, and the long-term curative effects of specific agents (such as fluoride) are uncertain [4]. Since Youyou Tu was awarded the Nobel Prize in 2016, Traditional Chinese Medicine (TCM) has become a considerable focus of research in the quest for to developing safer and more effective anti-osteoporotic drugs.
Benefiting-Bone Capsule (BBC) is an herbals formula, mainly consisting of seven traditional Chinese medicines (TCM) including Epimedium, Chinese wolfberry, and Radix Rehmanniae Preparata. A BBC drug serum has been shown to promote proliferation, differentiation, and mineralization of OB [5] and apoptosis of OC [6], in vitro, while in vivo, a water extract of BBC ameliorated osteoporosis in ovariectomized rats [7]. Clinically, the water extract of BBC improved symptoms of OP with no obvious toxicity or adverse reaction revealed during the six-month of experimental period [8], supporting its potential efficacy in the treatment and prevention of OP.
To explore the mechanisms underlying the anti-osteoporotic effects of the water extract of BBC, we focused on the Wnt/β- catenin and Notch signaling pathways. The Wnt protein family includes a number of cysteine-rich glycoproteins [9], including two ligands that are positively correlated with bone remodelling, Wnt3a [10-12] and Wnt10b [13,14]. In theory, the canonical Wnt/β-catenin signaling pathway is activated by Wnt proteins through release and accumulation of intracellular β- catenin, which are degraded by the proteosome through the key enzyme, glycogen synthesis kinase 3β (GSK-3β) when the pathway is turned off [15,16]. Increasing the Wnt signal suppresses Notch signaling through the combined activities of GSK-3β and Notch 2 [17], Conversely, increasing Notch signaling leads to inhibition of the Wnt downstream protein,β- catenin [18]. The Wnt and Notch signaling pathways coregulate several downstream targets, including the adipogenic differentiation factors, peroxisome proliferator-activated receptor γ (PPARγ).
We propose that the water extract of BBC exerts antiosteoporotic effects via regulation of the Notch and Wnt/β- catenin signaling pathways. Here, we focused on the effects of BBC extract on several key targets of these two signaling pathways in bone tissue. Our findings provide a basis for further exploration of BBC as an anti-osteoporotic drug and development of TCM as an effective treatment option in this field.
Materials and Methods
Materials
Animals: Specific Pathogen-Free (SPF) female Sprague– Dawley (SD) rats (aged 3 months and weighing 250 ± 20 g were provided by Guangdong Medical Laboratory Animal Center (Guangzhou, China) (Certificate Number: Guangdong SCXK 2013-0002).
Experimental medications: The liquid extract of benefitingbone capsule (Batch number: 20150601) containing 2.94 g active ingredient per gram was purchased from Guangzhou Boji Medical Biotechnological Co. Ltd. (Guangzhou, China), liquid extract has 2.94 g active ingredient per gram. The positive control drug, Fosamax (Product number: 130124), was purchased from MSD Pharmaceutical Co. Ltd. (Hangzhou, China).
Reagents: The alkaline phosphatase assay kit was acquired from Roche Ltd. (Basel, Switzerland) and the AST activity assay kit from Sekisui Medical Co., LTD. (Tongren Japan). OPG, BGP, and E2 ELISA test kits were purchased from Cloud-Clone Corp. (Wuhan China). Rat N1ICD and Jagged-1 polyclonal antibodies were obtained from Abcam plc. (Cambridge UK). Rat β-catenin, Wnt3a and GAPDH polyclonal antibodies were purchased from Cell Signaling Technology, Inc. (Boston Massachusetts USA). And rat Jagged-2 polyclonal antibody from Merck Millipore Co. (Darmstadt, Germany). Rat Wnt10b polyclonal and goat antirabbit secondary antibodies were obtained from OriGene Technologies, Inc. (Maryland USA) and EarthOx (Wuhan, China) respectively. Bovine serum albumin was purchased from Roche Ltd. (Basel, Switzerland). RNA reverse transcription and RT-PCR SYBR® kits were from TaKaRa Biotechnology (Dalian) Co., Ltd. (Dalian, China) Phenyl methane sulfonyl fluoride (PMFS) were purchased from Sigma–Aldrich Co. Ltd. (Shanghai, China) and the bicinchoninic acid (BCA) protein assay kit from KeyGEN Biotech. Co. Ltd. (Nanjing, China). SDS-PAGE gel preparation kit, protein loading buffer (5x) and electrophoresis liquid were acquired from the Beyotime Institute of Biotechnology (Haimen, China). Other commercially available reagents and chemicals used were of analytical grade.
Instrumentation: The following equipment was employed: a dual X-ray absorptiometer (Lunar Prodigy, GE Co., Pittsburgh, PA, USA), a microplate absorbance reader (Model 680, Bio- Rad Co., Hercules, CA,USA), micro-CT system (u-CT80, SCANCO Medical AG, Switzerland), multi-function biomechanics tester (MTS Model 858, Bionix Co., Toledo, OH, USA), inverted phase-contrast microscope (Model CKX41, Olympus Co., Tokyo, Japan), fluorescence spectrophotometer (Nano Drop 1000, Thermo Co., Waltham, MA, USA), G-Storm Gradient PCR thermal cycler (Veriti 96- Well, Applied Biosystems Co.), quantitative fluorescence PCR system (Light Cycler® 480, Roche Diagnostics Company Ltd.), gel imaging system (Bio-Rad Co.) and biomechanical instrumentation (3510-AT,BOSE Co., USA).
Methods
Components analysis of BBC liquid extract: Qualitative and quantitative analyses of the chemical constituents of BBC liquid extract were performed by using HPLC-Q/TOF-MS, The Agilent 6200 Series 6210 G1969A TOF LC/MS Mass Spectrometer system (Waldbronn, Germany) was employed for data acquisition and Mass Hunter Qualitative Analysis DA Software B.06.00 (Santa Clara, CA, USA) for data analysis. Errors were calculated by analysing three batches of BBC liquid extract. All reference standards of BBC liquid extract (>98% purity) were purchased from the Guangdong Institute for Drug Control (Guangzhou, China). Chromatographic separation was performed on COSMOSIL 38020-41 5C18- MS- (4.6 × 250 mm) (Nacalai Tesque, Inc., Japan) at 25°C. The mobile phase comprised a mixture of water containing 100% formic acid (A) and methanol (B). Linear gradient elution was conducted as follows: 0–45 min at 10–100% B, 45–60 min at 100% B. The flow rate was 1.0 mL/min and injection volume was 25 μL. UV detection was performed at 210 nm.
Animals and groups: SPF rats were reared by the Jinan University Medical Laboratory Animal Center and had free access to water and standard laboratory chow (1.01% Ca2+, 0.78% P3+).
Eighty-four rats were randomly divided into an ovariectomized non-treatment group (OVX-NT) (70 animals) that developed OP and sham-operated group (14 animals). After 20 weeks, rats were subjected to the dual-energy X-ray bone mineral density (BMD) test. The OP model was successfully established as described previously [19,20]. The OVX-NT group was randomly divided into five groups of 14 rats: nontreatment group (OVX-NT), a low-dose BBC group (BBC-L), medium-dose BBC group (BBC-M), high-dose BBC group (BBC-H) and a Fosamax-treated positive control group (FOS). Rats underwent treatment for 12 weeks.
BBC dosage was as follows: 0.52 g/200 g*d (low-dose group), 1.56 g/200 g*d (middle-dose group), and 4.68 g/200 g*d (highdose group). BBC and Fosamax were dissolved in distilled water to unify the volume and administered via oral gavage. The dosage of gavage administration in rats was 1, 3 and 9 times of the normal dose used in humans, as measured based on the active ingredient. Treatment regimens were as follows (Table 1): (1) sham-operated, water (Sham group); (2) OVX, water (OVX-NT group); (3) OVX, 0.52 g/200 g/day (low-dose BBC-L group); (4) OVX, 1.56 g/200 g/day (middle-dose BBCM group); (5) OVX, 4.68 g/200 g/day (high-dose BBC-H group); and (6) OVX, 0.514 mg/kg/day Fosamax (FOS group).
| Group | Model | Drug | Dose | Dosing period | Administration |
|---|---|---|---|---|---|
| Sham group | Sham | Water | / | 12weeks | Oral gavage |
| OVX-NT group | OVX | Water | / | 12 weeks | Oral gavage |
| BBC-L group | OVX | BBC | 0.52g/200g/day | 12 weeks | Oral gavage |
| BBC-M group | OVX | BBC | 1.56g/200g/day | 12 weeks | Oral gavage |
| BBC-H group | OVX | BBC | 4.68 g/200g/day | 12 weeks | Oral gavage |
| FOS group | OVX | Fosamax | 0.514 mg/kg/day | 12 weeks | Oral gavage |
Table 1: Treatment groups (dose measurements based on the active ingredient)
Dual-energy X-ray absorptiometry (BMD): After 20 weeks, BMD (bone mineral density) was evaluated via dual X-ray scanning. Rats were anesthetized and scanned. Bone mineral densities of femora and fourth and fifth lumbar vertebrae (LV4, 5) were measured.
Enzyme-Linked Immunosorbent Assay (ELISA): Blood plasma was collected using the abdominal aortic method. A serum separator tube was used and samples allowed to clot for 30 min before centrifugation for 10 min at 3000×g. Serum was removed and assayed immediately or divided into aliquots and stored at −20 or −80. Repeated freeze-thaw cycles were avoided. OPG, BGP, and E2 ELISA kits were used to test the respective indexes. According to protocol instructions, the microtiter plate reader was used as the standard for determination of test results.
Assessment of biochemical parameters: Serum was obtained with the above method. Serum levels of Ca2+, P3+, ALP [Alkaline Phosphatase] and AST [Aspartate Aminotransferase] were detected using an automatic biochemistry analyzer.
Micro-CT: Right femora and LV 5 were separated, dissected free of soft tissues and stored at −80°C for subsequent analyses. The microarchitecture of trabecular bone in the right proximal femora and LV4 was analyzed using micro-CT (60 KV, 50 W). The same specimen was scanned to obtain images of different sections and distal femoral stem epiphyseal and vertebral scans performed in three spatial dimensions. Micro View software was employed to calculate: trabecular thickness (Tb. Th), trabecular number (Tb. N), trabecular separation (Tb. Sp) and Trabecular Bone Pattern Factor (TBPF).
Three-point bending and compression tests: Samples were obtained using the method described above. The maximum impact force of different groups in the three-point bending test was investigated using rat femoral samples. The maximum axial compressive load of different groups was in a compression test using rat LV 5.
Hematoxylin-Eosin (HE) staining: Bone femoral tissues were decalcified and sliced with paraffin embedding, followed by processing with HE staining. Sections were examined and images obtained under an optical microscope.
Immuno histochemical staining: One third of the right distal femur was fixed with 4% paraformaldehyde, followed by fixing with 20% EDTA for decalcification at 4°C, dehydrated, and embedded in paraffin. Five micron paraffin sections were prepared for immunohistochemical staining. Slices were dewaxed using xylene and hydrated with an alcohol gradient. Endogenous peroxidase activity was quenched (3% hydrogen peroxide) and the slices incubated with Jagged1, Wnt3a and Wnt10b primary antibodies respectively (1:1000 dilution), at 37°C for 1h. Slices were washed three times with phosphate buffer, incubated with streptavidin˗ HRP˗ conjugated secondary antibodies at 37°C for 10 min, and washed another three times with phosphate buffer. Diamino benzidine (DAB) ˗ colored slices were then stained with hematoxylin and dehydrated using alcohol. Xylene was added and the slices sealed using neutral gum.
Quantitative fluorescence PCR: Chopped rat femora were treated with liquid nitrogen and ground into powder. Total RNA was extracted from femora by triturating several times with TRIzol reagent and allowing to stand at room temperature for 5 min. Chloroform was added (1/5th˗volume of TRIzol) and the sample blended in a vortex mixer. After standing at room temperature for 5 min, the mixture was centrifuged (12,000 g) for 5 min at 4°C. The top 70% of the aqueous phase (0.5 mL) was transferred to an Eppendorf tube and shaken with isopropyl alcohol (0.25 mL), 0.8 M aqueous sodium citrate solution (0.125 mL) and 0.125 M aqueous NaCl solution (0.8 mL). After standing at room temperature for 10 min, the mixture was centrifuged (12,000 g) for 15 min at 4°C, washed twice with 75% ethanol and the sediment dissolved in Di Ethyl Pyro Carbonate (DEPC)-treated water (20 μL). Avoiding bubbles, RNA samples (1 μL) were placed in the spectrophotometer and the ratio of absorbance at 260 nm and 280 nm (A260/A280) determined to provide an assessment of purity. Total RNA (1 μg) was reverse˗ transcribed into cDNA. Template DNA was used in gene-specific PCR for PPARγ, Runx 2, Notch 1, Notch 2, GSK-3β, β-Catenin and GAPDH mRNA. Details of the primers are listed in Table 2. Quantitative PCR for gene expression was performed in 96- well plates in a total reaction volume of 20 μL per well, comprising 2 × SYBR green master mix diluted gene primers (10 μL), cDNA (2 μL), forward primer (0.8 μL) or reverse (0.8 μL), primer and DEPC-treated water (6.4 μL). Quantitative analysis was performed using a Roche Light Cycler 480 Sequence Detection System. Operating conditions were as follows: 95°C for 30 s, 95°C for 5 s, and 60°C for 30 s for a total of 40 cycles. The fluorescence signal was collected at the end of the second step of each cycle. Each sample was analyzed in triplicate and average Ct values calculated. Gene expression was quantified using the ΔΔCt approach.
| Gene name | Primer sequence |
|---|---|
| PPARγ | Forward: 5′-GACCACTCCCATTCCTTTGACAT -3′ Reverse: 5′-TCAGAATAATAAGGCGGGGACG -3′ |
| Runx 2 | Forward: 5′-AGCGGACGAGGCAACAGTTT-3′ Reverse: 5′-CCTAAATCACTGAGGCGGTCAG-3′ |
| Notch 1 | Forward: 5′- CCAGGGTGGTCAGGAAAGTC -3′ Reverse: 5′- GCAGCCACAGATGTATGAAGACTC -3′ |
| Notch 2 | Forward: 5′- AGTGGTATGGACTGTGAGGAGG -3′ Reverse: 5′- CAGGAGAAGGTGTTCACTTTGTC -3′ |
| GSK-3β | Forward: 5′-ACACCTGCCCTCTTCAACTTTACC-3′ Reverse: 5′-ATTGGTCTGTCCACGGTCTCCA-3′ |
| β-Catenin | Forward: 5′-ACTCTAGTGCAGCTTCTGGGTTCTG-3′ Reverse: 5′-CTCGGTAATGTCCTCCCTGTCA -3′ |
| GAPAH | Forward: 5′-CAACGGGAAACCCATCACCA-3′ Reverse: 5′-ACGCCAGTAGACTCCACGACAT-3′ |
Table 2: Primer sequences for quantitative fluorescence PCR
Western blot analysis: Rat femora were subjected to cell lysis to extract proteins. Total protein concentrations were determined using the BCA protein assay kit. Proteins (30 μg) were separated via 12% SDS–PAGE and transferred onto Poly vinylidene difluoride (PVDF) membranes. Membranes were blocked with buffer containing 0.05% Tween˗20 and 5% skimmed milk and reacted sequentially with the appropriate primary and secondary antibodies. The primary antibodies used were specific for Jagged 2, β-Catenin and GAPDH (1:1000 dilutions) and secondary antibody was membranes were washed and rinsed with Enhanced Chemiluminescence (ECL) detection reagents, and immunoreactive bands visualized using ECL substrates and an X-ray film processor. Protein expression was measured using Quantity One®software.
Statistical analysis
Values are expressed as means ± standard deviations (SD). The significance of differences between the two experimental groups was estimated via one-way analysis of variance. Data were considered statistically significant at p values<0.05. All statistical evaluations were performed using SPSS version 19.0.
Results
Chemical constituents of BBC liquid extract
Qualitative and quantitative analyses of the chemical constituents of the liquid extract were performed using HPLCMS. Five bioactive components were identified, as shown in (Figure 1).
Establishment of the OP model and effects of the extract on BMD
At 20 weeks after OVX, BMD of LV4, 5, right femur and left femur was significantly reduced in the OVX-NT group relative to the sham-operated group (p<0.05), indicating the successful establishment of the OP model (Figure 2).
After the treatment period, BMD of the OVX-NT group was significantly lower than that of the Sham group reduction (p<0.05). Compared with the OVX-NT group, BMD of the parameters examined in the FOS and BBC groups was significantly increased (p<0.05); In particular, highest BMD was observed for the BBC-H. The results are shown in (Figure 3).
Figure 3. After 12 weeks of treatment, mice were anesthetized and the whole body scans conducted. BMD values of the whole body, femora, tibias, and LV4, 5 were measured. BMD in proximal and distal femurs was significantly lower in the OVX-NT than Sham group. Compared with the OVX-NT group, BMD of the lumbar spine, left and right proximal femora and right distal femur in the FOS group was increased. BMD values in the BBC treatment groups were significantly increased. Δp<0.05 indicates vs sham group, *p<0.05 indicates vs OVX-NT group.
The water extract of BBC improves E2, BGP and OPG in serum
Compared with the sham group, Estradiol (E2), Bone Gla Protein (BGP) and Osteoprotegerin (OPG) levels in sera of OVX-NT groups were significantly lower (p<0.05). Notably, serum E2, BGP and OPG levels of FOS, BBC-H, and BBC-M groups were significantly increased relative to those of the OVX-NT group (p<0.05). We additionally observed increased serum E2 and OPG levels in BBC-L rats increased (p<0.05). The results are presented shown in (Figures 4-6).
Figure 4. E2 levels in the six groups. Compared with the Sham group, E2 levels in serum samples of the OVX-NT group was significantly lower (Δp<0.05). Compared with the OVX-NT group, E2 levels in FOS, BBC-L, BBC-M, and BBC-H groups were markedly increased (*p<0.05).Δp<0.05 indicates vs. Sham group*p<0.05 indicates vs. OVX-NT group.
Figure 5. BGP levels in the six groups. Compared with the Sham group, BGP levels in serum samples of the OVX-NT group were significantly lower (Δp<0.05). Compared with the OVX-NT group, BGP levels of positive control, BBC-M, and BBC-H groups were significantly increased. Δp<0.05 vs Sham group*p<0.05 vs. OVX-NT group.
The water extract of BBC improves trabecular bone indicators
Micro-CT analysis revealed that compared with the Sham group, bone trabecular number (Tb. N) and trabecular thickness (Tb. Th) of the OVX-NT group were significantly lower (p<0.05), while trabecular separation/spacing (Tb. Sp) and trabecular bone pattern factor (Tb. Pf) were markedly increased (p<0.05). All treatment groups displayed similar trends in trabecular bone parameters Sham group (Figures 7 and 8).
Figure 7. After 12 weeks of treatment, femur tissues were examined using Micro-CT. Results are expressed as means ± standard deviations (n=10). Tb. N and Tb. Th values were significantly decreased in the OVX-NT, relative to the Sham group (p<0.05), while Tb. Sp and Tb. Pf values were significantly increased (p<0.05). Tb. N and Tb. Th values of FOS and BBC-H groups were significantly higher compared to the OVX-NT group (*p<0.05). Tb. N: Trabecular Number; Tb. Th: Trabecular Thickness; Tb. Sp: Trabecular Separation.
Figure 8. Micro-computed tomography analysis for (a) Sham, (b) OVX-NT, (c) FOS, (d) L-BBC, (e) M-BBC and (f) H-BBC groups. Comparison with the Sham group, bone trabecula was loose and fractured and exhibited a loss in the OVX-NT group. Following oral administration of the BBC extract bone trabecular number was clearly increased and the trabecula more densely concatenated than that in the OVX-NT group. Tb. N: Trabecular Number; Tb. Th: Trabecular Thickness; Tb. Sp: Trabecular Separation; OVX-NT, ovariectomy and oral administration of normal saline; BBC, benefiting-bone capsule; Sham, sham˗operated; FOS, treated with alendronate sodium; LBBC, Low-dose BBC group (0.71 g/kg•d); MBBC, Middle-dose BBC group (2.13 g/kg•d); H-BBC, High-dose BBC group (6.39 g/kg•d).
HE staining of pathological sections of distal femur showed that trabecular bone of OVX-NT rats was reduced, sparse, irregular and partially fractured, compared with the Sham group. Poor connectivity between the trabecular bones contains a lot of trabecular bone blind side. The number of hematopoietic cells decreased along with an increase in marrow cavity and fat droplets. However, morphological structures in the BBC-H group were similar to those of the Sham group. Staining data are shown in (Figure 9).
Figure 9. Histopathology of femurs from the six groups: (a) Sham, (b) OVX-NT, (c) FOS, (d) L-BBC, (e) M-BBC and (f) H-BBC groups. Hematoxylin and eosin staining (magnification, ×40). OVX, ovariectomy; BBC, benefitingbone capsule; Sham, sham-operated; FOS, treated with alendronate sodium; L-BBC, Low-dose BBC group (0.71 g/kg•d); MBBC, Middle-dose BBC group (2.13 g/kg•d); HBBC, High-dose BBC group (6.39 g/kg•d). Δp<0.05 vs. Sham group*p<0.05 vs. OVX-NT group.
After 12 weeks of treatment, lumbar vertebral tissue was examined via micro-CT. Results are expressed as means ± standard deviations (n=10). Tb. N and Tb. Th values were significantly decreased, while Tb. Sp and Tb. Pf values of the OVX-NT group were significantly increased, relative to the Sham group (Δp<0.05). Among the treatment groups, Tb. N and Tb. Th values of FOS and BBC-H groups were significantly higher compared with the OVX-NT group (*p<0.05), (Figure 10).
Figure 10. Micro-computed tomography analysis of LV5 for (a) Sham, (b) OVX-NT, (c) FOS, (d) L-BBC, (e) M-BBC and (f) H-BBC groups. Compared with the Sham group, the OVX-NT group exhibited loss of bone trabecula as well as loose and fractured appearance. Following oral administration of BBC, bone trabecula number was clearly increased and more densely concatenated relative to the OVXNT group, with the HBBC group showing the greatest improvement. FOS, treatment with alendronate sodium; L-BBC, Low-dose BBC group (0.71 g/kg•d); M-BBC, Middle-dose BBC group (2.13 g/kg•d); H-BBC, High-dose BBC group (6.39 g/kg•d).
The water extract of BBC improves bone maximum load
Three-point bending and compression tests disclosed that relative to the Sham group, maximum load of LV5 and femur in OVX-NT rats was significantly lowers (p<0.05). Compared with the OVX-NT group, the maximum load of the femur was significantly increased in the FOS and BBC treatment groups (p<0.05), while that of LV5 showed a marked increase in the BBC-H group (p<0.05), (Figure 11).
The water extract of BBC regulates key proteins and mRNAs of the Notch signaling pathway
The BBC extract inhibits Jagged1 protein expression: Immunohistochemical analysis Jagged1 distribution in the bone marrow cavity on fat cell membranes. Compared with the OVX-NT group, expression of Jagged1 protein was lower in the sham-operated and BBC-H groups (Figure 12). The average density was determined using Image-Pro Plus 6.0 Image analysis software. In relation to the sham-operated group, expression of Jagged1 was significantly increased in the OVX-NT group (p<0.01). The Jagged1 protein level was decreased in the BBC-H group, compared with the OVX-NT group (Figure 13).
Figure 13. Relative expression quantity of Jagged1 in the marrow cavity. Expression in the OVX-NT group was significantly increased compared with the Sham group. Notably, protein expression was significantly decreased after 12 weeks of treatment in the high-dose BBC-H, (6.39 g/kg•d). Δp<0.05 vs Sham group, *p<0.05 vs OVX-NT group.
The water extract of BBC enhances Runx2 mRNA and suppresses PPARγNotch1 and Notch2 mRNA: Q-PCR experiments showed that compared with the Sham group, expression of PPARγNotch1 and Notch2 mRNA levels were increased (p<0.05), while that of Runx2 was decreased in the OVX-NT group (p<0.05). In the BBC-H group, expression of PPARγ, Notch1 and Notch2 mRNA was decreased (p<0.05), to a significant extent, relative to the OVX-NT group (Figure 14).
Figure 14. Q-PCR analysis of relative expression of Runx 2 mRNA. Expression in the OVX-NT group was significantly decreased, compared with that in the Sham group, but increased markedly after 12 weeks of treatment in the BBC-H group (6.39 g/kg•d). Crosscurrent in the expression of PPARγ Notch1 and Notch2 mRNA. Δ p<0.05 vs Sham group, *P<0.05 vs OVX-NT group.
BBC inhibits Jagged2 protein expression: Western blot data showed that relative to Sham group, expression of Jagged2 was significantly increased in the OVX-NT group (p<0.05). Following treatment, we observed a marked decrease in Jagged2 protein expression (p<0.05) in the BBC-H group, compared with the OVX-NT group (Figure 15).
BBC regulates transcript and protein levels of key layers the Wnt/β-catenin signaling pathway
BBC treatment enhances Wnt3a and Wnt10b protein expression: Immunohistochemical analyses showed that compared with the Sham group. Expression of these proteins increased in the BBC-H treatment group, compared with the OVX-NT group. The average density was determined using Image-Pro Plus 6.0 Image analysis software, and results are presented in (Figure16).
Figure 16. A: Sham group, B: VOX-NT group, C: BBC-H group, D: FOS group. Analysis with Image-Pro Plus 6.0 showed decreased expression of Wnt3a and Wnt10b proteins in the OVX-NT group, compared with the Sham group. Compared with the OVX-NT group, Wnt3a and Wnt10b protein expression were increased in the BBC-H group. Δp<0.05 vs Sham group, *p<0.05 vs OVX-NT group.
BBC enhances β-catenin mRNA and protein expression
Total RNA integrity test results revealed successful total RNA extraction (Figure 17). Amplification and melting curves of QPCR confirmed the success of PCR. Q-PCR data showed that compared with the Sham group, expression of GSK-3β mRNA was significantly increased (p<0.05) and β-Catenin mRNA was decreased in the OVX-NT group (p<0.05). Conversely, relative to the OVX-NT group, expression of GSK-3β mRNA was significantly decreased (p<0.05) and that of β-Catenin mRNA was significantly increased in the BBC-H group (p<0.05). Consistently, western blot data showed that compared with the Sham group, β-catenin protein expression was significantly lower (p<0.05) in the OVX-NT group, and increased in the BBC-H group (p<0.05).
Discussion
Osteoporosis is a significant global health problem, and the development of safe and effective anti-osteoporotic drugs remains an urgent unmet medical need. While Traditional Chinese Medicine (TCM) has been proven by empirical science to be safe and effective in the prevention and cure of osteoporosis, reliable evidence to support their efficacy and safety of TCM formulations is lacking in experimental science. TCM is an exceptional source of potentially useful medications and drug targets. However, the exact mechanisms underlying the pharmacological effects of components of TCM components remain to be established.
In this study, we examined the effects of holistic treatment in ovariectomized rats. Fosamax was selected as the positive control, owing to its documented therapeutic effect on OP. Our results showed that BBC effectively reduces bone mass loss in OVX-NT rats, enhances bone trabecular number and thickness, reduces the degree of separation of trabecular bone, and improves its morphological structure. BBC-H (6.39 g/kg•d) exerted the most pronounced effect on these indices, indicative of the most significant therapeutic effect on osteoporosis and suggesting a dose-dependent curve. Serum aspartate aminotransferase (AST) of rats was not significantly different among BBC, FOS, and Sham groups, signifying that BBC and FOS exert no toxic side effects on liver during the treatment period. ELISA results disclosed that BBC promotes expression of the bone formation related factors estrogen (E2), Bone Gla Protein (BGP) and osteoprotegerin (OPG). Previous clinical studies have reported that BBC improves the symptoms of OP, with no obvious toxicity or adverse reactions over six-month experimental period [21]. The collective findings clearly indicate that BBC effectively improves OP, supporting its potential utility as a treatment/ prevention agent.
Importantly, we observed effects of BBC on several targets of the Notch signaling pathway. After treatment with BBC, expression of Notch1 and Notch2 mRNA decreased significantly in bone tissue of OP rats. Western blot and immunohistochemical analyses showed that compared with the OVX-NT group, Jagged1 and 2 protein levels were significantly decreased upon BBC treatment, leading to the proposal that BBC may function in blocking the Notch signaling pathway. The biological processes of OP are mainly linked by MSCs, OB, and OC. MSCs are multipotent stem cells that can differentiate into OB, chondroblasts, and lipoblasts, among other cell types. OBs generate bone matrix and fiber, and subsequently, calcified bone matrix, resulting in the formation of bone tissue [22]. Campa et al. [23] demonstrated that the Notch1-Jagged 1, 2 pathways plays a role in MSC osteogenic differentiation. In human MSCs, over expression of Jagged1 and Delta1 through transfection also promotes mineralization and enhances the alkaline phosphatase (ALP) level [24,25]. Another study showed that silk proteins stimulate osteoblast differentiation by suppressing the Notch signaling pathway in MSCs [26,27]. In a hypoxia tolerance test, Hilton and co-workers demonstrated that Notch 1 inhibits osteogenic differentiation of MSCs. The activity of the Notch signaling pathway and the expression of Notch 1 were increased in hypoxia, leading to decreased osteogenic differentiation ability of MSCs, while even under hypoxic conditions, inhibition of Notch 1 promoted MSC differentiation into OB [28]. In addition, knockout of Notch1-3 is reported to stimulate differentiation to OC in bone source macrophages, while the lack of Notch1 inhibits secretion of OPG in OC [29]. Clinically, compared to healthy women, Jagged1 and Notch 1 levels are significantly increased in MSCs of patients with postmenopausal OP [30]. In osteoclast precursors, suppression of the Notch 1 signal promotes differentiation into OC, implying that BBC can suppress bone metabolism though regulation of ALP and OPG (Figure 18).
Figure 18. Notch 1, 2, 3, and 4 are four receptors of the Notch family. Notch ligands are transmembrane proteins with conserved structures. Five known Notch ligands exist in mammals: Delta1, 3, and 4 and Jagged1 and 2. Ligand binding to receptors results in successive proteolytic cleavage mediated by TADE metalloproteases and a γ- secretase complex. Cleavage of the Notch receptor results in the release of a constitutively active Notch intra-cellular domain (NICD) that translocates to the nucleus where it binds various transcription complexes and affects the expression of downstream genes [43,44].
On the other hand, after treatment with BBC, expression of PPARγ mRNA decreased and Runx 2 mRNA increased in bone tissue of OP rats. HES and HEY, two of the downstream target genes of Notch signaling, have been shown to reduce the transcriptional activity of Runx2, leading to inhibition of osteogenic differentiation of MSCs [31] CBF1, the positive adjustment factor of osteogenic differentiation, down regulates the Notch-Hes1/Hey1 signal, resulting in increased expression of Runx2. [32]. Activation of the Notch signal can directly promote adipogenic differentiation and indirectly suppress osteogenetic differentiation of MSCs. This may be related to peroxisome proliferator activated receptor γ (PPARγ), which initiates the whole process of adipogenic differentiation when activated [33]. PPARγ, a downstream target of Notch signaling pathway, directly reflects the adipocyte differentiation status of MSCs. In rat MSCs with knock out of the PPARγ gene, adipogenic differentiation is entirely replaced by non-induced osteogenic differentiation. Notch 1 gene suppression inhibits adipogenic differentiation [34]. The data indicate that PPARγ and Notch 1 inhibit osteogenetic differentiation of MSCs. Accordingly, we suggest that BBC promotes exerts a therapeutic effect on OP via regulation of PPARγ and Runx2.
We additionally examined the effects of BBC on the Wnt/β- catenin signaling pathway. BBC treatment enhanced protein expression of Wnt3a, Wnt10b andβ-catenin, indicating activation of Wnt/β-catenin signaling. In vitro experiments have shown that Wnt3a directly induces differentiation of OB and inhibits differentiation of OC [35], while in vivo, lack of Wnt3a potentially leads to OP [36]. In mice, defects in the Wnt10 gene resulted in the bone loss and reduction of trabecular bone, while in Wnt10 overexpressing transgenic mice, bone mineral density was significantly increased [37]. Wnt10b protein promotes osteogenesis by increasing Runx2 and inhibiting adipogenesis through reduction of C/EBPα and PPARγ [38]. β-Catenin is the key protein in the Wnt/β-catenin signaling pathway. During mouse embryo development, lack of β-catenin completely inhibits osteogenic differentiation [39].
Moreover, BBC induced a significant decrease in GSK-3β mRNA, a key enzyme of β-catenin phosphorylation, and degradation by the Axin/APC/GSK 3β complex in the cytoplasm. GSK-3β enhances expression of the Hes-1 precursor. Cross-talk between Notch and Wnt signaling pathways is partly mediated by phosphorylation of GSK-3β [40]. During this process, over-expression of the Notch signal promotes adipogenesis and inhibits osteogenesis [41], and additionally downregulates Wnt receptors and downstream targets of Wnt/β-catenin, consequently inhibiting OB [42].
The Wnt family is composed of 19 lipidated and glycosylated proteins that play essential roles in diverse processes. Among these, Wnt3a and Wnt10b are closely related to bone metabolism. If Wnt signaling pathways are not activated, β-catenin in the cytoplasm will combine with the APC/Axin/ GSK-3β complex, which, in turn, phosphorylates β-catenin leading to enzymatic degradation. In cases where the Wnt signaling pathways is activated, Wnt proteins combine with surface membrane Frizzled receptor and its co-receptor, LRP5/6, leading to activation of Dsh proteins in the cytoplasm, which inhibits degradation of β-catenin by suppressing phosphorylation activity. Consequently, β-catenin accumulates in the cytoplasm and translocates to the nucleus, where it combines with TCF-4/LEF, promotes the expression of downstream target proteins, Runx2 and Osterix, and upregulates osteogenic differentiation of MSCs [45].
BBC activates the Wnt/β-catenin pathway through up regulation of Wnt3a and Wnt10b proteins and glycogen synthesis kinase 3β (GSK-3β) mRNA and inhibition of Jagged1, 2 protein and Notch 1, 2 mRNA. Moreover, BBC exerts its effects through elevating runt-related transcription factor 2 (Runx 2) and suppressing peroxisome proliferatoractivated receptor γ (PPARγ) mRNA expression.
Conclusion
BBC potentially improves OP and regulate correlation factor through modulation of protein and mRNA expression of key factors in Notch and Wnt/β-catenin pathways. Further preclinical investigations are required to identify the pharmacological targets of BBC and clarify the relationships between the different signaling pathways involved to optimize its application as an effective treatment option for OP.
Acknowledgements
The Lunar Prodigy dual-energy X-ray absorptiometer used in this study was a generous gift from The First Affiliated Hospital of Jinan University. This work was supported by the National Natural Science Foundation of China (No. 81473509 and 81673837), Science and Technology Planning Project of Guangdong Province, China (2016A020226039) and the national natural fund youth science fund project (No. 8150
References
- NIH Consensus Development Panel on Osteoporosis Prevention, Diagnosis, and Therapy. Osteoporosis prevention, diagnosis, and therapy. JAMA 2001; 285: 785-795.
- Simas V, Hing W, Pope R, Climstein M. Effects of water-based exercise on bone health of middle-aged and older adults: a systematic review and meta-analysis.Open Access J Sports Med 2017; 8: 39-60.
- Maghbooli Z, Hossein-Nezhad A, Jafarpour M, Noursaadat S, Ramezani M, et al. Direct costs of osteoporosis-related hip fractures: protocol for a cross-sectional analysis of a national database.BMJ Open 2017; 7: e014898.
- Tabatabaei-Malazy O, Salari P, Khashayar P. New horizons in treatment of osteoporosis.Daru 2017; 25: 2.
- Xiaochun Shu, Ronghua Zhang, Keping Peng. The dose-and time-effect relationships of Benefiting-bone Capsule on proliferation of Osteoblasts [J]. Traditional Chinese Medicinal Materials (in Chinese). 2003;26:644-647.
- Xiaochun Shu, Ronghua Zhang, Xiaofeng Zhu, et al. The effect of Benefiting- bone Capsule drug serum on apoptosis of rat osteoclast and secrete tartrate-resistant acid phosphatase [J]. Chinese Journal of Pathophysiology(in Chinese). 2003;19:1234-1237.
- Aiwu Yang, Ronghua Zhang, Hongsheng Lv, et al. Bone histomorphometry index and volume change and therapeutical effect of Benefiting-bone Capsule in ovariectomized rats [J]. Chinese Journal of Clinical Rehabilitation (in Chinese). 2005; 9: 165-167.
- ZHANG Ronghua, Chen Ke ji, Lu Da xiang, Zhu Xiao feng, Ma Xiao chang. A Clinical Study of Yigu Capsule in Treating Postmenopausal Osteoporosis(2005), Chinese Journal of Integrated Traditional and Western Medicine. 2005;11:97-103
- Prakash S, Swaminathan U. Î catenin in health: A review.J Oral Maxillofac Pathol 2015; 19: 230-238.
- Velázquez-Cruz R, García-Ortiz H, Castillejos-López M. Wnt3a gene polymorphisms are associated with bone mineral density variation in postmenopausal mestizo women of an urban mexican population: Findings of a pathway-based high-density single nucleotide screening[J]. Age. 2014;36: 1483-1492.
- de Boer J1, Siddappa R, Gaspar C, van Apeldoorn A, Fodde R, et al.. Wnt signaling inhibits osteogenic differentiation of human mesenchymal stem cells. Bone. 2004; 34: 818-826.
- Ling L, Dombrowski C, Foong KM, Haupt LM, Stein GS. Synergism between Wnt3a and heparin enhances osteogenesis via a phosphoinositide 3-kinase/Akt/RUNX2 pathway. J Biol Chem. 2010; 285: 26233-26244.
- Bennett CN, Longo KA, Wright WS, Suva LJ, Lane TF. Regulation of osteoblastogenesis and bone mass by Wnt10b. Proc Natl Acad Sci U S A. 2005; 102: 3324-3329.
- Bennett CN, Ouyang H, Ma YL, Zeng Q, Gerin I, et al.. Wnt10b increases postnatal bone formation by enhancing osteoblast differentiation. J Bone Miner Res. 2007; 22: 1924-1932.
- Clevers H. Wnt/beta-catenin signaling in development and disease. Cell 2006; 127: 469-480.
- MacDonald BT, Tamai K, He X. Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell. 2009; 17: 9-26.
- Espinosa L, Inglés-Esteve J, Aguilera C, Bigas A. Phosphorylation by glycogen synthase kinase-3 beta down-regulates Notch activity, a link for Notch and Wnt pathways. J Biol Chem 2003; 278: 32227-32235.
- Sciaudone M, Gazzerro E, Priest L, Delany AM, Canalis E. Notch 1 impairs osteoblastic cell differentiation. Endocrinology 2003; 144: 5631-5639.
- Devlin H1, Ferguson MW. Compositional changes in the rat femur following ovariectomy. Acta Anat (Basel). 1989; 136: 38-41.
- Kalu DN. Evaluation of the pathogenesis of skeletal changes in ovariectomized rats. Endocrinology. 1984; 115: 507-512.
- Zhang Rong-hua, Chen Ke-ji, LU Da-xiang,ZHU Xiao-feng, MA Xiao-chang. A Clinical Study of Yigu Capsule in Treating Postmenopausal Osteoporosis(2005), Chinese Journal of Integrated Traditional and Western Medicine. 2005;11: 97-103.
- Chen Q, Shou P, Zheng C. Fate decision of mesenchymal stem cells: adipocytes or osteoblasts?[J]. Cell Death & Differentiation. 2016; 23:1128-1139.
- Campa VM, Gutiérrez-Lanza R, Cerignoli F, Díaz-Trelles R, Nelson B. Notch activates cell cycle reentry and progression in quiescent cardiomyocytes.J Cell Biol. 2008; 183: 129-141.
- Nobta M, Tsukazaki T, Shibata Y. CritBBCl regulation of bone morphogenetic protein-induced osteoblastic differentiation by Delta1/Jagged1?2 activated Notch 1 signaling [J]. J Biol Chem. 2005;280: 15842-15848.
- Evans A G, Calvi L M. Notch signaling in the malignant bone marrow microenvironment: implications for a niche-based model of oncogenesis [J]. Annals of the New York Academy of Sciences. 2015; 1335: 63-77.
- Jung S R, Song N J, Yang D K, et al. Silk proteins stimulate osteoblast differentiation by suppressing the Notch signaling pathway in mesenchymal stem cells [J]. Nutr Res. 2013; 33: 162-170.
- Hilton M J, Tu X, Wu X, et al. Notch signaling maintains bone marrow mesenchymal progenitors by suppressing osteoblast differentiation [J]. Nat Med. 2008, 14: 306–314.
- Bai S, Kopan R, Zou W, Hilton MJ, Ong CT, et al.. NOTCH1 regulates osteoclastogenesis directly in osteoclast precursors and indirectly via osteoblast lineage cells. J Biol Chem 2008; 283: 6509-6518.
- Yanjie J, Jiping S, Yan Z, Xiaofeng Z, Boai Z. Effects of Notch-1 signalling pathway on differentiation of marrow mesenchymal stem cells into neurons in vitro. Neuroreport 2007; 18: 1443-1447.
- Boopathy AV, Pendergrass KD, Che PL, Yoon YS, Davis ME. Oxidative stress-induced Notch1 signaling promotes cardiogenic gene expression in mesenchymal stem cells.Stem Cell Res Ther. 2013; 4: 43.
- Evans A G, Calvi L M. Notch signaling in the malignant bone marrow microenvironment: implications for a niche-based model of oncogenesis [J]. Annals of the New York Academy of Sciences. 2015; 1335: 63-77.
- Bai S, Kopan R, Zou W. NOTCH 1 regulates osteoclastogenesis directly in osteoclast precursors and indirectly via osteoblast lineage cells [J]. J Biol Chem, 2008; 283: 6509-6518.
- Lecarpentier Y, Claes V, Vallée A. Interactions between PPAR gamma and the canonical Wnt/beta-catenin pathway in type 2 diabetes and colon cancer [J]. PPAR research. 2017:9.
- Abdallah B M, Jafari A, Zaher W, Skeletal (stromal) stem cells: an update on intracellular signaling pathways controlling osteoblast differentiation[J]. Bone. 2015, 70: 28-36.

















