Biomedical Research

Research Article - Biomedical Research (2018) Volume 29, Issue 3

Retracted: Relationship of polymorphism of adhesion molecules VCAM-1 and ICAM-1 with preeclampsia

Ya Chen, Ying Zhang and Yunxia Cao*

Department of Obstetrics and Gynecology, the First Affiliated Hospital of Anhui Medical University, Hefei, PR China

*Corresponding Author:
Yunxia Cao
Department of Obstetrics and Gynecology
The First Affiliated Hospital of Anhui Medical University, PR China

Accepted on November 15, 2017

DOI: 10.4066/biomedicalresearch.29-17-3066

Visit for more related articles at Biomedical Research

Abstract

Objective: To investigate relationship of polymorphism of adhesion molecules VCAM-1 and ICAM-1 with preeclampsia.

Method: The present study included 252 patients with PE in our hospital during 2014 February to 2016 December and 200 healthy pregnant women were used as control. Allelic discrimination of the rs5498 polymorphisms of the ICAM-1 gene and rs3181092 of the VCAM-1 gene was assessed using the TaqMan assay. Data was analysed using SPSS 18.0.

Results: In PE patients, both ratios of AA and AA+AG genotypes of VCAM-1 were significantly higher than those in the control group, P<0.05. Comparison of genotypes between PE patients of early-onset and late-onset showed that in late-onset PE patients, ratio of AA genotype in VCAM-1 was significantly higher than that in the early-onset group, P<0.05. Similarly, ratio of genotype AA in severe PE patients was significantly higher than that in mild PE patients, P<0.05. However, in all comparisons, distribution of rs5498 polymorphism of ICAM-1 showed no significant difference in different groups.

Conclusion: Rs3181092 polymorphism of VCAM-1 was associated with occurrence of PE, especially for late-onset and severe PE patients. However whether rs5498 polymorphism of ICAM-1 was associated with PE needed more investigation.

Keywords

Polymorphism, VCAM-1, ICAM-1, Preeclampsia.

Introduction

Preeclampsia (PE), a severe complication of pregnancy and one of the leading causes for mortality and morbidity in mothers and fetuses, is characterized by new onset of proteinuria and hypertension after 20 w of gestation and affects about 2%~10% pregnant women all over the world [1-3].

It is thought that PE has been associated with insufficient trophoblast invasion of maternal spiral arteries, placental ischemia, impaired placental perfusion, activation of thrombosis, and widespread endothelial cell dysfunction [4-6]. However, the causes for these pathophysiological mechanisms are still unclear. It is considered that genetic factors play an important role in etiology of PE with an estimated heritability of 54% for PE [7].

Studies show that Intercellular Adhesion Molecule-1 (ICAM-1), a transmembrane glycoprotein which is expressed in endothelial cells and leukocytes in the immune system, is associated with disorders of female reproductive system such as endometriosis, ovarian stimulation syndrome, and preeclampsia [8,9]. The Vascular Cell Adhesion Molecule-1 (VCAM-1), an immunoglobulin like transmembrane protein, is also involved in many inflammatory related diseases [10,11]. It has been proven that polymorphisms in the VCAM-1 promoter can affect the expression of VCAM-1 [12]. Studies also showed that polymorphisms of ICAM-1 and VCAM-1 genes have been implicated as genetic risk factor in several autoimmune diseases [13,14]. However, to our best knowledge, few studies focused on the relationship of polymorphisms of ICAM-1 and PE, and no study has been reported on polymorphisms of VCAM-1 in PE patients.

In the present study, we aimed to investigate polymorphism of adhesion molecules VCAM-1 and ICAM-1 in preeclampsia and demonstrate relationship of polymorphism of VCAM-1 and ICAM-1 with PE. The present study would firstly demonstrate relationship of polymorphism of adhesion molecules VCAM-1 with preeclampsia, and might provide a new target and better understanding for study and treatment of PE.

Materials and Methods

Patients

The present study included 252 patients with PE in our hospital during 2014 February to 2016 December. The diagnosis of PE was confirmed according to clinical findings including increased blood pressure (≥ 140 mmHg systolic or ≥ 90 mmHg diastolic on 2 or more measurements at least 6 h apart) and proteinuria ≥ 0.3 g/24 h or ≥ +1 on a urine dipstick after 20 w of gestation [7]. Patients were further divided into early-onset and late-onset subgroups according to gestational age of disease onset. Early onset PE was defied as preeclampsia that developed before 34 w of gestation, and late onset PE was defined as which developed at or after 34 w of gestation. Severe PE was defined as severe hypertension (SBP>150 mmHg or DBP>100 mmHg) or severe proteinuria (>2.0 g in a 24 h urine collection or >3+ by dipstick test) [4]. Patients with the following characteristics were excluded: infected patients; patients with chronic hypertension or patients with gestational hypertension but without proteinuria; patients with multiple pregnancies; patients with autoimmune, metabolic, or cardiovascular diseases and patients with other severe systemic diseases. Data of 200 health controls was collected from healthy pregnant women who went to our hospital at the same period. This study was approved by Ethic committee of the First Affiliated Hospital of Anhui Medical University.

Determination of the genotype

Peripheral blood was collected and DNA was extracted as described elsewhere [15]. Allelic discrimination of the rs5498 polymorphisms of the ICAM-1 gene and rs3181092 of the VCAM-1 gene was assessed with the ABI StepOneTM Real- Time PCR System (Applied Biosystems, Foster City, CA, USA), and analysed with SDS vers. 3.0 software (Applied Biosystems) using the TaqMan assay [15]. Primer sequences used in the study were as follows: ICAM-1 rs5498, forward CCATCGGGGAATCAGTGACT, reverse, ATGACTGCGGCTGCTACCA; VCAM-1 rs3181092, forward GGAGATGTTTCACGAAGTTTGT, reverse, AAGGGTCACATTTTGAGTATCC.

Statistical analysis

The measurement data was expressed by mean ± SD. Independent continuous variables were compared using the ttest and categorical data such as differences in allelic and genotypic frequencies of different groups were compared using the chi square test or Fisher exact test. Hardy-Weinberg equilibrium was determined by chi square test. Cross-products (Odds ratio (OR)) with a 95% confidence interval (95% CI) was also recorded. A P-value was less than 0.05 it was considered to be statistically significant. All analyses were made using SPSS 18.0.

Results

Clinical basic information for all participants

The present study included 252 patients with PE 200 health controls. Data of maternal age, gestation age, delivery weeks, birth weight, blood pressure, proteinuria and family history of hypertension were collected. As shown in Table 1, except for blood pressure, proteinuria and family history of hypertension, other characteristics showed no significant difference between the patients and the control. However in patients of PE, the mean blood pressure, amount of proteinuria and ratio of family history of hypertension were all significantly higher than those of the control group, P>0.05.

  Patients, n=252, (%) Control, n=200, (%) P value OR ( 95% CI)
Maternal age, year 29.5 ± 5.4 28.3 ± 7.2 0.693  
Gestation age, day 8.1 ± 1.6 8.4 ± 1.8 0.785  
Birth weight, kg 2.6 ± 0.5 2.9 ± 0.2 0.326  
Systolic blood pressure 169.3 ± 21.6 112.8 ± 13.7 0.000  
Diastolic blood pressure 110.4 ± 11.3 74.9 ± 15.4 0.000  
Proteinuria 3.6 ± 0.6 0.3 ± 0.1 0.005  
Delivery mode        
Vaginal delivery 181 (71.8) 139 (69.5) 0.721 1.117 (0.608~2.054)
Caesarean delivery 71 (28.2)  61 (30.5)    
Family history of hypertension 41 (16.3) 3 (1.5) 0.000 12.788 (2.342~69.827)

Table 1. Basic clinical information for patients and the control.

Comparison of genotypes between PE patients and the control

As shown in Table 2, genotypes for rs3181092 in VCAM-1 and rs5498 in ICAM-1 were analysed in all PE patients and the control group. The distribution of both VCAM-1 and ICAM-1 polymorphism genotypes was in Hardy-Weinberg equilibrium for cases and controls. Results showed that in PE patients, both ratios of AA and AA+AG genotypes of VCAM-1 were significantly higher than those in the control group, P<0.05. Ratio of A was also higher in patients than in the control, however the difference was not significant. On the other hand, distribution of rs5498 polymorphism of ICAM-1 showed no significant difference between patients and the control group. These results suggested that genotype A of VCAM-1 rs3181092 might be associated with incidence of PE.

Variable Patients, n=252, (%) Control, n=200, (%) P value OR ( 95% CI)
VCAM-1 rs3181092        
Genotype        
GG 25 (9.9) 40 (20.0)   Ref=1
AG 148 (58.7) 112 (56.0) 0.078 2.118 (0.910~4.930)
AA 79 (31.3) 48(24.0) 0.038 2.635 (1.041~6.670)
AG+AA 227 (90.1) 160 (80.0) 0.045 2.275 (1.003~5.161)
Allele        
G 198 (39.3) 192 (48.0)   Ref=1
A 306 (60.7) 208 (52.0) 0.215 1.426 (0.813~2.499)
ICAM-1 rs5498        
AA 109 (43.3) 85 (42.5)   Ref=1
AG 113 (44.8) 91 (45.5) 0.910 0.966 (0.535~1.745)
GG 30 (11.9) 24 (12.0) 0.953 0.973 (0.393~2.410)
AG+GG 143 (56.7) 115 (57.5) 0.909 0.968 (0.553~1.695)
Allele        
A 331 (65.7) 261 (65.3)   Ref=1
G 173 (34.3) 139 (34.7) 1.000 0.982 (0.548~1.760)

Table 2. Comparison of genotypes for PE patients and the control.

Comparison of genotypes between PE patients of early-onset and late-onset

Comparison of genotypes between PE patients of early-onset and late-onset was then conducted and the results were shown in Table 3. Results showed that in late-onset PE patients, ratio of AA genotype in VCAM-1 was significantly higher than those in the early-onset group, P<0.05. Ratios of AA+AG and allele A were also higher in late-onset patients than in earlyonset patients, however the difference was not significant. And similar to above, distribution of rs5498 polymorphism of ICAM-1 showed no significant difference between the two groups.

Variable Early-onset, n=79, (%) Late-onset, n=173, (%) P value OR (95% CI)
VCAM-1 rs3181092        
Genotype        
GG 10 (12.7) 15 (8.7)   Ref=1
AG 55 (69.6) 93 (48.0) 0.989 0.993 (0.389~2.537)
AA 14 (17.7) 65 (43.3) 0.012 0.280 (0.101~0.780)
AG+AA 69 (87.3) 158 (91.3) 0.360 0.655 (0.263~1.629)
Allele        
G 75 (47.5) 123 (35.5)   Ref=1
A 83 (52.5) 223 (64.5) 0.085 0.608 (0.345~1.073)
ICAM-1 rs5498        
AA 31 (39.2) 78 (45.1)   Ref=1
AG 42 (53.2) 71 (41.0) 0.183 1.493 (0.827~2.695)
GG 6 (7.6) 24 (13.9) 0.353 0.629 (0.236~1.680)
AG+GG 48 (60.8) 95 (54.9) 0.398 1.274 (0.726~2.236)
Allele        
A 104 (65.8) 227 (65.6)   Ref=1
G 54 (34.2) 119 (34..4) 0.976 0.991 (0.553~1.777)

Table 3. Comparison of genotypes between PE patients of early-onset and late-onset.

Comparison of genotypes between severe and mild PE patients

Difference of genotypes between severe and mild PE patients was at last analysed. As shown in Table 4, ratio of genotype AA in severe PE patients was significantly higher than that in mild PE patients, P<0.05. The difference of ratios of AA+AG and allele A was not significant. What’s more, genotype of ICAM-1 rs5498 showed no significant difference.

Variable Mild, n=166, (%) Severe, n=86, (%) P value OR (95% CI)
VCAM-1 rs3181092        
Genotype        
GG 20 (12.0) 5 (5.8)   Ref=1
AG 101 (60.8) 47 (54.7) 0.244 0.537 (0.187~1.545)
AA 45 (27.1) 34 (39.5) 0.045 0.332 (0.110~1.001)
AG+AA        
Allele        
G 141 (42.5) 57 (33.1)   Ref=1
A 191 (57.5) 115 (66.9) 0.170 0.669 (0.377~1.190)
ICAM-1 rs5498        
AA 72 (43.4) 37 (43.0)   Ref=1
AG 73 (44.0) 40 (46.5) 0.830 0.938 (0.520~1.691)
GG 21 (12.6) 9 (10.5) 0.713 1.189 (0.473~2.987)
AG+GG 94 (56.6) 49 (57.0) 0.954 0.984 (0.562~1.722)
Allele        
A 217 (65.4) 114 (66.3)   Ref=1
G 115 (34.6) 58 (33.7) 0.893 1.041 (0.580~1.867)

Table 4. Comparison of genotypes between severe and mild PE patients.

Discussion

As one of the leading causes for mortality and morbidity in mothers and fetuses, Preeclampsia (PE) remains to be a worldwide healthy problem [16]. Though detailed mechanisms for occurrence of PE are still unclear, it is thought that genetic factors are crucial in development of PE. Intercellular Adhesion Molecule-1 (ICAM-1) and Vascular Cell Adhesion Molecule-1 (VCAM-1) are adhesion molecules which have been proven to be associated with many diseases including gynecological diseases like endometriosis [17] or PE [18]. However to our best knowledge, few studies focused on polymorphism of VCAM-1 and ICAM-1 in preeclampsia.

In the present study, for the first time we demonstrated that rs3181092 polymorphism of VCAM-1 was associated with occurrence of PE, however whether rs5498 polymorphism of ICAM-1 was associated with PE needed more investigation.

Studies showed that the single nucleotide G/A polymorphism in the sixth exon of the ICAM-1 gene (K469E, rs5498) could result in an amino acid substitution from glutamic acid (E) to lysine (K) in immunoglobulin-like domain 5 of the ICAM-1 protein which is important for the activity of the ICAM-1 protein in many diseases. Lin et al demonstrated that ICAM-1 single-nucleotide polymorphisms were associated with oral cancer susceptibility and clinicopathologic development [15]. Popovic et al. showed that polymorphism rs5498 of the ICAM-1 gene affected the progression of carotid atherosclerosis in patients with type 2 diabetes mellitus [19]. Studies also showed that K469E polymorphism of the ICAM-1 gene was associated with retinopathy in type 2 diabetes [20]. Recently, Tabatabai et al. studied genotype of ICAM-1 gene K469E polymorphism in 192 PE patients and found that K469E polymorphism was associated with severe preeclampsia; however in comparison of PE patients and the control, K469E polymorphism showed no significant difference [21]. However in the present study, we found that rs5498 polymorphism of ICAM-1 not only showed no significant difference in patients and the control, but also showed no significant difference in comparison for patients of early-onset and late-onset, as well as comparison for patients of mild and severe PE. This difference with other studies might be due to the different study population and sample size, which needs more clinical evidences to confirm.

On the other hand, we found that rs3181092 polymorphism of VCAM-1 was associated with occurrence of PE. There are very few studies focusing on this mutant target. A genetic study showed that rs3181092 polymorphism of VCAM-1 might be associated with risk of chronic lymphatic leukemia [22]. There is also a study demonstrating that rs3181092 in VCAM-1 was associated with carotid plaque [23]. However up to now, no studies show relationship of VCAM-1 and preeclampsia, we are the first to demonstrate that AA genotype for rs3181092 polymorphism of VCAM-1 may be associated with occurrence of PE.

In conclusion, the present demonstrated that rs3181092 polymorphism of VCAM-1 was associated with occurrence of PE; ratio of AA genotype of rs3181092 of VCAM-1 was significant higher in PE patients, especially for late-onset and severe PE patients. However whether rs5498 polymorphism of ICAM-1 was associated with PE needed more investigation. The present study would firstly demonstrate relationship of polymorphism of adhesion molecules VCAM-1 with preeclampsia, and might provide a new target and better understanding for study and treatment of PE.

References